Jump to content
Le_Nain

ERRATA Colle n°6 04/11/19 - Génome

Recommended Posts

SALUT A TOUS !!! :rangs:

 

Vous pouvez débattre ici des potentiels errata de la colle concernant la partie Génome ! :tat:

 

Ps : Pour les personnes qui viennent en invité sur le forum vous pouvez vous créer un compte dessus ça sera plus simple pour poser les questions 😉

 

Merci d'être venu aussi nombreux ! Un peu déçu de ne pas avoir vu beaucoup de déguisement 😞

Share this post


Link to post
Share on other sites
Guest Guitou

Bonjour et merci pour la colle,

Pour le QCM 17 aux items D et E vous avez pas échangé les réponses ? car avec la correction que vous donnez c'est la E qui est juste et non la D car dans le ligne "E", les cases sont rouges ce qui montre que ce sont des cellules souches BOUH et donc qu'il y a des télomérases non ?

Share this post


Link to post
Share on other sites
Guest Bouh purpan
il y a 13 minutes, Invité Guitou a dit :

Bonjour et merci pour la colle,

Pour le QCM 17 aux items D et E vous avez pas échangé les réponses ? car avec la correction que vous donnez c'est la E qui est juste et non la D car dans le ligne "E", les cases sont rouges ce qui montre que ce sont des cellules souches BOUH et donc qu'il y a des télomérases non ?

+1

Share this post


Link to post
Share on other sites
il y a 20 minutes, Invité Guitou a dit :

Bonjour et merci pour la colle,

Pour le QCM 17 aux items D et E vous avez pas échangé les réponses ? car avec la correction que vous donnez c'est la E qui est juste et non la D car dans le ligne "E", les cases sont rouges ce qui montre que ce sont des cellules souches BOUH et donc qu'il y a des télomérases non ?

 

SI ! On a échangé les deux réponses sinon la justification est bonne !

On devait vous l'annoncer en amphi mais on a oublié.

Du coup la D est Fausse et la E est vraie.

Share this post


Link to post
Share on other sites

Je ne comprends pas pourquoi la E est comptée juste,

si les cDNA codant pour les genes de la télomérase s'étaient fixés dans la ligne E, alors il n'y aurait pas de fixations des cDNA des cellules différenciées

Or, on voit bien en E6 qu'il y a fixation du cDNA des cellules différenciés! 

Share this post


Link to post
Share on other sites

Bonjour, tout d’abord merci pour la colle. Pour la question 16C il me semble que les séquences ne sont pas complètement complémentaires. Cela devrait bloquer la traduction mais l’item est compté faux 

Share this post


Link to post
Share on other sites
Guest Helloo

Bonjour ! Merci pour la colle 🙂 j’ai un petit  soucis pour le qcm 13 le c et d , cette partie n’a pas été encore vu en cours , c’est dans le chapitre 3 ( diapo 12 ) , merci ! 

Share this post


Link to post
Share on other sites
Guest coucou
il y a 8 minutes, Invité Helloo a dit :

Bonjour ! Merci pour la colle 🙂 j’ai un petit  soucis pour le qcm 13 le c et d , cette partie n’a pas été encore vu en cours , c’est dans le chapitre 3 ( diapo 12 ) , merci ! 

je suis totalement d'accord avec toi

Share this post


Link to post
Share on other sites
Il y a 1 heure, Geoooo a dit :

Bonjour, tout d’abord merci pour la colle. Pour la question 16C il me semble que les séquences ne sont pas complètement complémentaires. Cela devrait bloquer la traduction mais l’item est compté faux 

Je suis d'accord 

Share this post


Link to post
Share on other sites
Il y a 2 heures, Invité Helloo a dit :

Bonjour ! Merci pour la colle 🙂 j’ai un petit  soucis pour le qcm 13 le c et d , cette partie n’a pas été encore vu en cours , c’est dans le chapitre 3 ( diapo 12 ) , merci ! 

+1

Share this post


Link to post
Share on other sites
Il y a 2 heures, Invité Helloo a dit :

Bonjour ! Merci pour la colle 🙂 j’ai un petit  soucis pour le qcm 13 le c et d , cette partie n’a pas été encore vu en cours , c’est dans le chapitre 3 ( diapo 12 ) , merci ! 

+1

(même j'avais trouvé au feeling)

Edited by Jadilie

Share this post


Link to post
Share on other sites
Il y a 3 heures, Geoooo a dit :

Bonjour, tout d’abord merci pour la colle. Pour la question 16C il me semble que les séquences ne sont pas complètement complémentaires. Cela devrait bloquer la traduction mais l’item est compté faux 

@GretaThunberg

Le problème en ce qui concerne l'ARNm 4 c'est que la séquence complémentaire à celle de l'ARNmi (3' UAACCGGCUAGCUUAAGGCUAGC 5') est dans le sens 5' -> 3' au lieu d'être dans le sens 3' -> 5' du coup l'ARNmi ne va même pas s'hybrider avec cet ARNm car ils ne sont pas complémentaires.

En gros que tu cherches le complémentaire de l'ARNmi ça te donne

ARNmi :5'  AUUGGCCGAUCGAAUUCCGAUCG 3'

Son complémentaire (qui doit être contenu dans l'ARNm dans ce sens) : 3' UAACCGGCUAGCUUAAGGCUAGC 5' (5' CGAUCGGAAUUCGAUCGGCCAAU 3')

Hors la séquence de l'ARNm 4 est : 5' CCGAUACGAUCGAAUAACCGGCGUUACGCAGGCUAGCGCAUAUUCAAGCA 3'

Tu vois que  la séquence de l'ARNm 4 est mal orientée par rapport à ce qu'on attend vis à vis du complémentaire de l'ARNmi.

 

 

Il y a 2 heures, Invité Helloo a dit :

Bonjour ! Merci pour la colle 🙂 j’ai un petit  soucis pour le qcm 13 le c et d , cette partie n’a pas été encore vu en cours , c’est dans le chapitre 3 ( diapo 12 ) , merci ! 

@Piccola @Jadilie

Oups, désolé ...

Bah on va les annuler alors.

 

Il y a 4 heures, maestro a dit :

Je ne comprends pas pourquoi la E est comptée juste,

si les cDNA codant pour les genes de la télomérase s'étaient fixés dans la ligne E, alors il n'y aurait pas de fixations des cDNA des cellules différenciées

Or, on voit bien en E6 qu'il y a fixation du cDNA des cellules différenciés! 

Je comprends ce que tu veux dire mais c'est pour ça qu'il y a écrit "probable". Comme tu raisonnes en terme de probabilités, et que tu remarques que dans ta ligne E il y a quand même une majorité d'ARNc provenant des ARNm de la cellule souche tu conclues qu'il y a plus de chances pour que les gènes codant pour la télomérase se soient fixés dessus.

C'est pas absolu comme réponse.

Je sais pas si c'est plus clair...

 

Révélation

 

Share this post


Link to post
Share on other sites

Dans quel cours on apprend que les gènes de structure sont exprimés dans toutes les cellules ?

Share this post


Link to post
Share on other sites

Coucou @Jadilie!

 

Effectivement on aurait pas dû être aussi catégorique dans la correction, les gènes de structure sont présents dans une majorité de cellules. En faisant le QCM, on pensait plutôt à différencier ces gènes des gènes différenciés (exprimés uniquement dans certaines cellules différenciées), il aurait été plus malin de parler de gène de ménage. Mais l'item reste vrai.

 

Désolée! ❤️

Share this post


Link to post
Share on other sites
il y a 3 minutes, Lilette a dit :

Coucou @Jadilie!

 

Effectivement on aurait pas dû être aussi catégorique dans la correction, les gènes de structure sont présents dans une majorité de cellules. En faisant le QCM, on pensait plutôt à différencier ces gènes des gènes différenciés (exprimés uniquement dans certaines cellules différenciées), il aurait été plus malin de parler de gène de ménage. Mais l'item reste vrai.

 

Désolée! ❤️

Je ne voulais pas contester l'item, juste savoir où je devais chercher cette info qui me manquait, notamment parce qu'en général les notions mal révisées ne sont pas seules, et en l'occurence la notion de gène de ménage ne me parle pas du tout ^^'

Et c'est pas un errata non plus, mais à la 19C, remplacer le C par un A en position 685 ne changerais pas CTA en ATA, plutôt que TGC en TGA ? Comme la séquence commence en 30, ça fait l'acide aminé 655 de la séquence, le multiple de 3 le plus proche c'est 654, donc c'est le premier aa du codon non ?

Share this post


Link to post
Share on other sites

@Jadilie

Les définitions des gènes sont dans le cours de M Salvayre :

Gènes domestiques (gènes de ménage; gènes domestique ou 'housekeeping'; genes constitutif): gènes exprimés dans toutes les cellules et impliqués dans le

métabolisme général nécessaire à la vie cellulaire.

 

Pour la 19C, tu t'es trompé d'ATG, celui dont tu parles n'est même pas dans la partie transcrite. L'ATG initiateur est en 311, donc en suivant le cadre de lecture tu vois bien  que le codon est TGC qui devient TGA.

 

Voilà les séquences importantes dans ce QCM:

 

1572901515-75264952-721745955005620-3216

 

LÉGENDE:

Orange : séquence kozak

Vert : ATG initiateur

Bleu clair : signal poly A 

Rose : IRES

Souligné : exon

Pas souligné : intron

Rouge : début et fin des introns

Saumon : codon stop si l'intron 1 est mal épissé

Bleu foncé : boite CCAAT

 

BON COURAGE!! (et n'hésite pas à venir nous voir à la perm si tu as encore des problèmes) ❤️

Share this post


Link to post
Share on other sites

Donc pour réacapituler

- annulation item C et D du QCM 13: pas encore traité en cours

- QCM 17: c'est la E qui est vraie et pas la D, la justification est bonne

Share this post


Link to post
Share on other sites
Le 04/11/2019 à 22:08, Lilette a dit :

@Jadilie

Les définitions des gènes sont dans le cours de M Salvayre :

Gènes domestiques (gènes de ménage; gènes domestique ou 'housekeeping'; genes constitutif): gènes exprimés dans toutes les cellules et impliqués dans le

métabolisme général nécessaire à la vie cellulaire.

 

Pour la 19C, tu t'es trompé d'ATG, celui dont tu parles n'est même pas dans la partie transcrite. L'ATG initiateur est en 311, donc en suivant le cadre de lecture tu vois bien  que le codon est TGC qui devient TGA.

 

Voilà les séquences importantes dans ce QCM:

 

1572901515-75264952-721745955005620-3216

 

LÉGENDE:

Orange : séquence kozak

Vert : ATG initiateur

Bleu clair : signal poly A 

Rose : IRES

Souligné : exon

Pas souligné : intron

Rouge : début et fin des introns

Saumon : codon stop si l'intron 1 est mal épissé

Bleu foncé : boite CCAAT

 

BON COURAGE!! (et n'hésite pas à venir nous voir à la perm si tu as encore des problèmes) ❤️

 

Comment reconnaît on que le signal poly A fait partie de la région 3´UTR de l’exon?

Merci pour l’explication!

Share this post


Link to post
Share on other sites

Elle ne doit pas être dans un intron ou un exon (il doit y avoir une précision sur la structure du gène ou la fin des exons/introns sinon vous ne pouvez pas le deviner) 😊

Share this post


Link to post
Share on other sites
Il y a 23 heures, Lilette a dit :

Elle ne doit pas être dans un intron ou un exon (il doit y avoir une précision sur la structure du gène ou la fin des exons/introns sinon vous ne pouvez pas le deviner) 😊

Super merci! 

Et comment fait on pour reconnaitre la semence de Kozak? et elle toujours identique?

Serai-t-il possible d'avoir une correction détaillée des items C et E du ccm 20? Je ne retrouve pas les bonnes séquences pour les amorces 

Merci!

 

Share this post


Link to post
Share on other sites

Bonjour,

Concernant l'item E du QCM 20 il est dit que l'amorce 3 est bien l'anti sens en 5' de l'intron 2 or je ne vois pas d'appariement de bases du coup il me semble que ce n'est pas ça. Apres ça ne change pas l'item qui reste faux. Si quelqu'un pouvait me confirmer si j'ai raison. Merci d'avance

Share this post


Link to post
Share on other sites

@Jerry00 @Théo81

 

Oui la séquence Kozak c'est toujours CC(A ou G)CCATG (codon initiateur)

Item B et C :

L'amorce antisens est normalement complémentaire au brin présenté mais y a une technique plus simple (je trouve) pour vérifier si l'amorce est bien une amorce antisens. Tu prends la séquence de ton amorce et tu écris son complémentaire puis tu le retourne pour l'avoir dans le sens 5' 3' ( en lecture de gauche à droite)  et tu regardes si tu retrouves cette séquence dans la séquence qui t'est donnée. Là normalement c'est le cas vu que la séquence complémentaire de l'amorce 2 orientée dans le même sens que le brin contient le codon stop et une dizaine de base le précédant.

 

Item D :

L'amorce sens a la même séquence (même composition en bases et dans le même sens) que la séquence que l'on te propose. L'amorce 2 contient le début de la séquence codante de la séquence présentée, donc item D vrai.

 

Item E

Même technique que précédemment sauf que là comme c'est un intron et qu'il a été épissé tu ne peux pas te servir de l'amorce. T'as même pas besoin de vérifier l'amorce en soit mais je t'avoue qu'en le faisant j'ai pas retrouvé la séquence. Donc soit je suis trop fatiguée, soit on a pas fait attention sachant que l'item serait faux de toute façon. Désolée.

687021702_Capturedcran2019-11-1100_04_56.thumb.png.648595351705c9a57c0f70db70a56d74.png

 

En espérant que ça ait quand même aidé !

 

Révélation

 

Share this post


Link to post
Share on other sites
Le 11/11/2019 à 01:16, Moumou a dit :

@Jerry00 @Théo81

 

Oui la séquence Kozak c'est toujours CC(A ou G)CCATG (codon initiateur)

Item B et C :

L'amorce antisens est normalement complémentaire au brin présenté mais y a une technique plus simple (je trouve) pour vérifier si l'amorce est bien une amorce antisens. Tu prends la séquence de ton amorce et tu écris son complémentaire puis tu le retourne pour l'avoir dans le sens 5' 3' ( en lecture de gauche à droite)  et tu regardes si tu retrouves cette séquence dans la séquence qui t'est donnée. Là normalement c'est le cas vu que la séquence complémentaire de l'amorce 2 orientée dans le même sens que le brin contient le codon stop et une dizaine de base le précédant.

 

Item D :

L'amorce sens a la même séquence (même composition en bases et dans le même sens) que la séquence que l'on te propose. L'amorce 2 contient le début de la séquence codante de la séquence présentée, donc item D vrai.

 

Item E

Même technique que précédemment sauf que là comme c'est un intron et qu'il a été épissé tu ne peux pas te servir de l'amorce. T'as même pas besoin de vérifier l'amorce en soit mais je t'avoue qu'en le faisant j'ai pas retrouvé la séquence. Donc soit je suis trop fatiguée, soit on a pas fait attention sachant que l'item serait faux de toute façon. Désolée.

687021702_Capturedcran2019-11-1100_04_56.thumb.png.648595351705c9a57c0f70db70a56d74.png

 

En espérant que ça ait quand même aidé !

 

  Révéler le contenu masqué

 

Super merci beaucoup! Je comprend mieux!

Share this post


Link to post
Share on other sites

Join the conversation

You can post now and register later. If you have an account, sign in now to post with your account.

Guest
Reply to this topic...

×   Pasted as rich text.   Paste as plain text instead

  Only 75 emoji are allowed.

×   Your link has been automatically embedded.   Display as a link instead

×   Your previous content has been restored.   Clear editor

×   You cannot paste images directly. Upload or insert images from URL.


  • Recently Browsing   0 members

    No registered users viewing this page.

×
×
  • Create New...