Jump to content

PRRRR


Go to solution Solved by Zoe.chvt,

Recommended Posts

Posted

bonjour, je ne comprend pas cmnt on est sensé trouver la séquence PRRRR qd on fait une "délétion ponctuelle de la 4e base" avec cette séquence : atgctggacgacagagccaggatggaggccgccaagaaggagaaggtagagcagatcctggcagagttccagct gcaggaggaggacctgaagaaggtgatgagacggatgcagaaggagatggaccgcggcctga

merci d'avance !

Posted (edited)

Slt, il faut utilisé le tableau des acide aminé donné en fin de sujet.

Chaque lettre correspond à un aa qui correspond à un OU PLUSIEURS codon.

Dit moi si t'as besoin de plus de précision  

Edited by PASSocio

Join the conversation

You can post now and register later. If you have an account, sign in now to post with your account.
Note: Your post will require moderator approval before it will be visible.

Guest
Reply to this topic...

×   Pasted as rich text.   Paste as plain text instead

  Only 75 emoji are allowed.

×   Your link has been automatically embedded.   Display as a link instead

×   Your previous content has been restored.   Clear editor

×   You cannot paste images directly. Upload or insert images from URL.

  • Recently Browsing   0 members

    • No registered users viewing this page.
×
×
  • Create New...